rs6058017 chr20:34269192 A>G
- Sequence
gcgcccccactcccggccgcgagc[A/G]ggcagggcttcggggacgcggggc
- ASB in cell types
- MS-1 (Small cell lung carcinoma) MOLT-4 (Adult T acute lymphoblastic leukemia) SMMC-7721 (hepatocellular carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.05 | 1.56 | 1.14 | 2.86 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
