rs6058794 chr20:32665475 C>G
- Sequence
gcttttggagacagtgctggggag[C/G]cccagtgaccaggccggaaacact
- ASB in cell types
- HepG2 (hepatoblastoma) GM19240 (B cells Lymphoblastoid Cell Lines) CTV-1 (Adult T acute lymphoblastic leukemia) K562 (myelogenous leukemia)
- ASB for transcription factors
- FLI1_HUMAN STAT1_HUMAN CTCF_HUMAN HTF4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FLI1_HUMAN | 3.39 | -3.73 | 1.00 | n/a | No Hit | |||
| STAT1_HUMAN | 2.44 | -0.08 | 2.00 | n/a | No Hit | |||
| CTCF_HUMAN | 1.12 | 0.72 | 1.36 | n/a | No Hit | |||
| HTF4_HUMAN | 2.21 | -0.67 | 1.50 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Thyroid