rs6060038 chr20:34769912 G>A
- Sequence
aaatatagctagtctgtggctgct[G/A]agctgaaaggctgcactcacccaa
- ASB in cell types
- RWPE2 MS-1 (Small cell lung carcinoma) hASC (preadipocytes) glioblastoma cells
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| RWPE2 | n/a | 0.91 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | -0.42 | 0.36 | 1.00 | |||
| hASC (preadipocytes) | -0.10 | 1.50 | 1.00 | |||
| glioblastoma cells | n/a | 0.54 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP alcohol dependence symptom count, comorbid depressive syndrome and alcohol dependence, fasting blood glucose, height, plasma protein-c levels, serum creatinine, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Pituitary, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood