rs6061104 chr20:32020243 A>G
- Sequence
taaaaacagtggtgaatgaaacag[A/G]catagttcctgtctagatggtgag
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ETS1_HUMAN | -1.10 | 1.73 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hypertension (early onset hypertension), mitral annular calcium, prop taste detection threshold, rheumatoid arthritis, tetrology of fallot, triglycerides
GTEx eQTL Adipose_Subcutaneous, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid