rs6061787 chr20:61742612 T>G
- Sequence
tacccacatttttataaataggag[T/G]taactttatccgtggcttttatga
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- EGR2_HUMAN ZFHX2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EGR2_HUMAN | -2.21 | 3.00 | 2.00 | n/a | No Hit | |||
| ZFHX2_HUMAN | n/a | 2.11 | 6.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, hdl cholesterol change with statins