rs6062175 chr20:62260436 T>A
- Sequence
ggatttggggtgacacaggctttg[T/A]cagggcctggcaaacagtacatgg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.93 | 1.50 | 2.36 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, ldl cholesterol change with statins, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), microalbuminuria, total cholesterol change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood