rs6062177 chr20:62267877 A>G
- Sequence
tcagggtatatctcaaatgtctgc[A/G]ttattttttatttatttatttttt
- ASB for transcription factors
- CLOCK_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CLOCK_HUMAN | -0.95 | 2.04 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, ldl cholesterol change with statins, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), microalbuminuria, normoxic and mild-hypoxic adaptation in populations residing at low and moderate altitudes, sporadic creutzfeldt-jakob disease, total cholesterol change with statins, variant creutzfeldt-jakob disease