rs6062238 chr20:62552488 T>C
- Sequence
ctcgctccgggctgtcccctcgca[T/C]ggacgggctgcctggaggagcaac
- ASB in cell types
- HDF(human dermal fibroblasts)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HDF(human dermal fibroblasts) | -0.49 | 1.80 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Hippocampus, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic