rs6062400 chr20:62674584 G>A
- Sequence
gatggtctctgactcacagatgac[G/A]attccaagggtctgagcggccctg
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 2.69 | -2.43 | 1.00 | -3.92 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP comorbid depressive syndrome and alcohol dependence, eye color, homa-b, neuroblastoma (brain cancer)