rs6062634 chr20:64120459 A>C
- Sequence
aggccagcgctggctctgccatgg[A/C]ggggaagcactttgaagccccact
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) neural cell neural progenitors MS-1 (Small cell lung carcinoma)
- ASB for transcription factors
- BHE40_HUMAN IKZF1_HUMAN IKZF2_HUMAN JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BHE40_HUMAN | n/a | 3.13 | 1.50 | n/a | No Hit | |||
| IKZF1_HUMAN | 2.10 | -0.11 | 1.12 | n/a | No Hit | |||
| IKZF2_HUMAN | 2.14 | -1.61 | 1.00 | n/a | n/a | |||
| JUN_HUMAN | 1.50 | 0.02 | 3.00 | n/a | No Hit |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Nucleus_accumbens_basal_ganglia, Brain_Putamen_basal_ganglia, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Minor_Salivary_Gland, Muscle_Skeletal, Nerve_Tibial, Pancreas, Prostate, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Whole_Blood