rs6063082 chr20:47191516 G>A
- Sequence
ggattagtggatggtggatggatg[G/A]agggatgggtgaatgagtggatgc
- ASB in cell types
- HepG2 (hepatoblastoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 1.24 | 0.43 | 1.04 | |||
| K562 (myelogenous leukemia) | 1.14 | -0.24 | 2.02 |
Items per page:
1 – 2 of 2