rs6063516 chr20:50440711 G>A
- Sequence
ccgctcaagacaacctcgtggtcc[G/A]ttcctttcattcgggctgctgtat
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) monocyte-derived macrophages from peripheral blood HS-ES-2M (Epithelioid sarcoma)
- ASB for transcription factors
- SPI1_HUMAN RXRA_HUMAN SKI_HUMAN RCOR2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 3.16 | 0.00 | 1.75 | -2.91 | Concordant | |||
| RXRA_HUMAN | 3.17 | n/a | 1.50 | n/a | No Hit | |||
| SKI_HUMAN | 2.31 | -2.04 | 1.00 | n/a | n/a | |||
| RCOR2_HUMAN | 2.72 | -2.39 | 1.00 | n/a | n/a | |||
| MAX_HUMAN | 1.66 | -0.32 | 1.56 | n/a | No Hit |
Items per page:
1 – 5 of 12
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, college completion, decrease in fev1/fvc ratio (in nonasthmatic participants), fasting blood glucose, ldl cholesterol, lung function, ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc) ratio percent predicted (in nonasthmatic participants), major depressive disorder (broad definition), major depressive disorder (broad definition) (females), years of education