rs6063634 chr20:51326441 A>G
- Sequence
gcttaacagtgacccctggtggcc[A/G]tgagacctgatggctttagtgtag
- ASB in cell types
- T47D (invasive ductal carcinoma) GM19238 (female B-cells lymphoblastoid cell lines) adrenal gland KMS-11 (Plasma cell myeloma)
- ASB for transcription factors
- CTCF_HUMAN SMC1A_HUMAN RAD21_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 2.15 | 0.74 | 1.68 | -0.33 | Weak Concordant | |||
| SMC1A_HUMAN | 2.33 | 0.71 | 1.75 | n/a | n/a | |||
| RAD21_HUMAN | 1.15 | 0.52 | 1.35 | n/a | n/a |
Items per page:
1 – 3 of 3
Motif analysis
Genetic associations
GRASP autism with low iq, fasting blood glucose, hypertension (early onset hypertension), salmonella-induced pyroptosis, years of education