rs6063986 chr20:53740107 C>T
- Sequence
tgcatacttcacactgagtaattc[C/T]tttccatctactcctttcatcttg
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) BEAS-2B (bronchial epithelium)
- ASB for transcription factors
- ZN687_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN687_HUMAN | 2.51 | -2.35 | 1.00 | n/a | n/a | |||
| IKZF2_HUMAN | 1.29 | -0.76 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, mitral annular calcium, refractive error, schizophrenia, total cholesterol