rs6064254 chr20:55642285 A>G
- Sequence
ggagccatgcactttgaagatgga[A/G]atagagatgccaggagctaaggaa
- ASB in cell types
- HUES64 (embryonic stem cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HUES64 (embryonic stem cells) | 2.31 | -0.82 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP bipolar disorder, childhood acute lymphoblastic leukemia, college completion, major depressive disorder, major depressive disorder and bipolar disorder combined analysis