rs6066823 chr20:48722230 C>G
- Sequence
caaatgtccatcagctaatgagtg[C/G]ataaacacaacgtggtccagccac
- ASB in cell types
- HCASMC (Human coronary artery smooth muscle cells) germinal center B-cells MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- JUND_HUMAN CBP_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUND_HUMAN | 2.77 | -2.44 | 1.00 | n/a | No Hit | |||
| CBP_HUMAN | 2.13 | -0.37 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2