rs6067129 chr20:49594391 C>A
- Sequence
ggtttctcaagaaaaaccagaaat[C/A]tagagatttacaagaagtttccca
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) HepG2 (hepatoblastoma)
- ASB for transcription factors
- RBM25_HUMAN ETS1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | 0.06 | 1.86 | 2.00 | n/a | n/a | |||
| ETS1_HUMAN | 2.56 | -2.35 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg