rs6067961 chr20:37869242 G>A
- Sequence
agaggaacggggcaaaataaagag[G/A]tagcaggagcaaaattacttcccc
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN PRD10_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.06 | 0.41 | 1.50 | n/a | No Hit | |||
| PRD10_HUMAN | n/a | 3.18 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, comorbid depressive syndrome and alcohol dependence, hdl cholesterol change with statins, ldl cholesterol, ldl cholesterol change with statins, microalbuminuria, resistance to kuru in aged women despite likely exposure, sporadic creutzfeldt-jakob disease, total cholesterol, total cholesterol change with statins, urinary albumin-to-creatinine ratio