rs60684329 chr8:73174292 T>C
- Sequence
aaaaaaaaaaaaaggcattgctcc[T/C]gcataatcaagggctatttttgca
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM12891 (male B- cells lymphoblastoid cell line) neural cell GM19239 (male B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.04 | 0.85 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1