rs6068643 chr20:53740495 C>G
- Sequence
tatgccttgtcacaagtacactca[C/G]tgaaacattaattcacgaagagat
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia) T47D (invasive ductal carcinoma) BEAS-2B (bronchial epithelium) CTV-1 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- PRGR_HUMAN GCR_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PRGR_HUMAN | 0.45 | 1.57 | 1.14 | n/a | No Hit | |||
| GCR_HUMAN | 1.18 | -0.10 | 2.00 | 3.34 | Discordant |
Items per page:
1 – 2 of 2
Motif analysis
