rs6068699 chr20:53875535 G>A
- Sequence
ttatcccccaaatgctcagttgaa[G/A]gttttgcctccaggtcagacatgg
- ASB in cell types
- MOLM14 (Adult acute myeloid leukemia)
- ASB for transcription factors
- CDK8_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CDK8_HUMAN | 1.75 | -1.39 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, cystatin c in serum, hdl cholesterol, hdl cholesterol change with statins, serum creatinine, total cholesterol, triglycerides, urinary albumin-to-creatinine ratio