rs6071497 chr20:61120901 T>C
- Sequence
gatcgtcagtttcctgaggcttcc[T/C]cagccctgtggaactgtgagtcaa
- ASB in cell types
- thyroid gland epithelial cell of prostate tibial nerve
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| thyroid gland | -1.93 | 2.26 | 1.00 | |||
| epithelial cell of prostate | 1.35 | -1.35 | 1.00 | |||
| tibial nerve | 2.14 | -1.58 | 1.00 |
Items per page:
1 – 3 of 3