rs6073136 chr20:43590625 T>C
- Sequence
cctggctccactctgctcctgcgc[T/C]ttgggaatcgaagctggggcgttc
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) BEAS-2B (bronchial epithelium) pancreas GM17942 (lymphoblastoid cell)
- ASB for transcription factors
- CTCF_HUMAN GCR_HUMAN ARNT_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.42 | 0.92 | 1.19 | n/a | No Hit | |||
| GCR_HUMAN | 1.23 | 0.12 | 2.00 | n/a | No Hit | |||
| ARNT_HUMAN | 2.96 | -3.10 | 1.00 | n/a | No Hit | |||
| STAG1_HUMAN | 0.19 | 1.06 | 1.05 | n/a | n/a |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GRASP height, infant head circumference, obesity with early age of onset (age >2), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Brain_Cerebellum, Cells_EBV-transformed_lymphocytes, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Small_Intestine_Terminal_Ileum, Spleen, Testis, Thyroid, Whole_Blood