rs6074022 chr20:46111557 C>T
- Sequence
ctgcctgagtgctgagtgtcctca[C/T]gacatggcagacagctgcttcccc
- ASB in cell types
- CD14+ monocytes
- ASB for transcription factors
- STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAT1_HUMAN | n/a | 3.26 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), alzheimers disease, bipolar disorder, comorbid depressive syndrome and alcohol dependence, infant head circumference, irritible bowel syndrome, kawasaki disease, multiple sclerosis, neuroblastoma (brain cancer), rheumatoid arthritis, spine bone mineral density (bmd), total cholesterol
PheWAS abnormal coagulation profile, abnormal results of function study of liver, acute pericarditis, alzheimers disease, anterior pituitary disorders, apnea, aseptic necrosis of bone, asthma, balanoposthitis, behcets syndrome, benign neoplasm of eye, benign neoplasm of other parts of digestive system, carbohydrate transport and metabolism disorder, cardiac arrhythmia nos, cardiac shunt/ heart septal defect, cerebral ischemia, cervicocranial/cervicobrachial syndrome, cholangitis, chronic airway obstruction, congenital anomalies of intestine, cystic mastopathy, decubitus ulcer, delirium dementia and amnestic disorders, delirium due to conditions classified elsewhere, dementias, disaccharide malabsorption, fracture of clavicle or scapula, generalized convulsive epilepsy, hematuria, hemiplegia, hypoventilation, infections of kidney, infertility, male, injuries to the nervous system, irregular menstrual bleeding, ischemic stroke, late effects of cerebrovascular disease, lower gastrointestinal congenital anomalies, lump or mass in breast, nonrheumatic aortic valve disorders, obstruction of bile duct, occlusion of cerebral arteries, other benign neoplasm of connective and other soft tissue, other diseases of lung, other disorders of pancreatic internal secretion, other specified disorders of pancreatic internal secretion, otitis externa, peripheral retinal degenerations, persistent mental disorders due to other conditions, pleurisy, pleural effusion, poisoning by agents primarily affecting blood constituents, respiratory abnormalities, respiratory insufficiency, secondary malignant neoplasm of digestive systems, senile dementia, spermatocele, temporomandibular joint disorder nos, testicular dysfunction, thoracic neuritis/radiculitis, transient cerebral ischemia
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Kidney_Cortex, Lung, Muscle_Skeletal, Nerve_Tibial, Ovary, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Stomach, Testis, Thyroid, Vagina, Whole_Blood