rs6075100 chr20:16749819 T>C
- Sequence
ggtattggcagctatgattctcac[T/C]atcagcaaagaggacgcctgcgag
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) bipolar neuron
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -3.90 | 3.35 | 1.17 | |||
| bipolar neuron | 1.88 | -0.40 | 1.17 |
Items per page:
1 – 2 of 2