rs6077113 chr20:6960033 C>T
- Sequence
tggtatttactcatttttgtgtga[C/T]gaatgtatgcaagaagtcatcatt
- ASB in cell types
- HeLa S3 (cervical adenocarcinoma) LHSAR (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HeLa S3 (cervical adenocarcinoma) | -0.47 | 1.88 | 1.62 | |||
| LHSAR (prostate epithelial cells) | -0.40 | 1.51 | 1.50 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, hdl cholesterol change with statins, spine bone mineral density (bmd), total cholesterol