rs6077441 chr20:956630 G>A
- Sequence
gttcctggttgactgccgtcatcc[G/A]gtggcagcatgtgggaatgacatg
- ASB in cell types
- SK-N-SH (neuroblastoma) WA01 (H1, human embryonic stem cells) glioblastoma cells GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- STAG1_HUMAN STAT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 0.29 | 0.38 | 1.11 | n/a | n/a | |||
| STAT1_HUMAN | 2.21 | -1.20 | 3.00 | n/a | No Hit |
Items per page:
1 – 2 of 2