rs6077516 chr20:9344622 A>C
- Sequence
tgtacagttcagttgttagaacag[A/C]caggaagatgatcctttgacaaca
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.01 | -0.50 | 1.83 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, body mass index (bmi), fasting insulin, homa-b, homa-ir, total cholesterol, total cholesterol change with statins