rs6082361 chr20:21265982 G>A
- Sequence
tctcccaggagagaggccagaacc[G/A]tctggagctcggggaagttgtccg
- ASB in cell types
- NCI-H2171 (small cell lung carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| NCI-H2171 (small cell lung carcinoma) | 0.09 | 2.56 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP biploar disorder (bipolar schizoaffective disorder), coronary artery disease (cad), height, ldl cholesterol, total cholesterol, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood