rs6082470 chr20:21615541 G>A
- Sequence
gagaaggatgggtgagcatgtgac[G/A]ttgggaaattgtattttcttcttc
- ASB in cell types
- glioblastoma cells RWPE2 PC9 (lung adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | n/a | 3.06 | 2.00 | |||
| RWPE2 | -2.68 | 1.75 | 1.50 | |||
| PC9 (lung adenocarcinoma) | 2.76 | -0.76 | 2.00 |
Items per page:
1 – 3 of 3