rs6083725 chr20:25040301 C>T
- Sequence
cagggcagccaacttcacacagaa[C/T]gctccagagcctggacgcaggttg
- ASB in cell types
- 22RV1 (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 2.67 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), birth weight, ldl cholesterol, sporadic creutzfeldt-jakob disease
GTEx eQTL Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Nucleus_accumbens_basal_ganglia, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood