rs6084801 chr20:4592535 C>G
- Sequence
gctatgagggcagggggtggcggg[C/G]agggcaacgtcccataccgtctaa
- ASB in cell types
- glioblastoma cells breast tumor xenograft
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| glioblastoma cells | 2.51 | -4.74 | 2.00 | |||
| breast tumor xenograft | -1.09 | 1.72 | 1.00 |
Items per page:
1 – 2 of 2