rs6085283 chr20:652315 C>T
- Sequence
aagggtcgggggaaggggacacaa[C/T]gttatgtaggcctaacctgacacc
- ASB in cell types
- HT1080 (fibrosarcoma)
- ASB for transcription factors
- SSRP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SSRP1_HUMAN | 1.86 | -0.25 | 1.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, body mass index (bmi), irritible bowel syndrome, ldl cholesterol, maternal transmission distortion, total cholesterol
GTEx eQTL Adipose_Visceral_Omentum, Brain_Cerebellar_Hemisphere, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Heart_Left_Ventricle, Lung, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Whole_Blood