rs6085866 chr20:7094625 A>C
- Sequence
tgccacctagcggcaggttgattg[A/C]attggctctcttccatcacggaag
- ASB in cell types
- HepG2 (hepatoblastoma) foreskin keratinocyte A673 (Ewing sarcoma) GBM39 (Human brain tumor)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.42 | 0.79 | 1.13 | |||
| foreskin keratinocyte | 0.61 | n/a | 2.50 | |||
| A673 (Ewing sarcoma) | -1.97 | 2.47 | 1.00 | |||
| GBM39 (Human brain tumor) | 1.93 | -0.08 | 2.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | -1.39 | 1.74 | 1.00 |
Items per page:
1 – 5 of 6