rs6086132 chr20:7637430 A>G
- Sequence
ttatctgctgcagagtgtttttct[A/G]tagctgtccacatcctgcccacac
- ASB in cell types
- SK-N-SH (neuroblastoma)
- ASB for transcription factors
- GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA3_HUMAN | -0.05 | 3.40 | 1.50 | 1.46 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP college completion, hypertension (early onset hypertension), serum creatinine, years of education