rs6089378 chr20:62447342 C>T
- Sequence
aacgggctgagctgatgacatttc[C/T]gacgcgctgggttagcgtacatcg
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- MNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | -3.13 | 1.77 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Cerebellum, Breast_Mammary_Tissue, Esophagus_Mucosa, Minor_Salivary_Gland, Testis, Thyroid