rs6089606 chr20:62010989 G>A
- Sequence
ctccaattttttaaacactccttt[G/A]caacttctgaaagcagggggcagt
- ASB in cell types
- CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ stem cells-derived erythroblasts | 2.61 | 0.19 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, response to lithium treatment for bipolar disorder, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Muscle_Skeletal, Pancreas, Thyroid, Whole_Blood