rs6089707 chr20:62260509 T>C
- Sequence
tgatttcctacagatctgcctgct[T/C]ttccatgggcggccaagttcatcc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) glioblastoma patient-derived cell model
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.28 | 1.21 | 2.42 | |||
| glioblastoma patient-derived cell model | -2.23 | 2.58 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP infant head circumference, ldl cholesterol change with statins, lung function, predicted ratio of forced expiratory volume in 1 second (fev1) to forced vital capacity (fvc) (fev1/fvc), microalbuminuria, total cholesterol change with statins
GTEx eQTL Adipose_Visceral_Omentum, Artery_Tibial, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood