rs6091130 chr20:50297815 C>A
- Sequence
tggatgtcgggcggagggctttcc[C/A]taatttcaatctcccaccagtcct
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia) macrophages form periferal blood monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.28 | 0.46 | 1.40 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP chronic kidney disease, hdl cholesterol, ldl cholesterol, microalbuminuria, nonsyndromic striae distensae (stretch marks), obesity with early age of onset (age >2), rheumatoid arthritis