rs6091410 chr20:51966274 T>G
- Sequence
aacagttgttattttaaaagaagg[T/G]tacaaagctgctcattgtattttt
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 0.04 | 2.04 | 4.00 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.11 | 1.46 | 3.96 |
Items per page:
1 – 2 of 2