rs6092601 chr20:58074478 G>A
- Sequence
gcggagtacagcggggagaaatcc[G/A]gagacatttcccagtcttgccaga
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TF65_HUMAN | 3.31 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, comorbid depressive syndrome and alcohol dependence, schizophrenia, spine bone mineral density (bmd), total cholesterol, triglycerides