rs6093306 chr20:40206092 A>G
- Sequence
acttcatgtacacttcagtaaatg[A/G]caactctttctctaacctgaaagc
- ASB in cell types
- MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 TamR (invasive ductal breast carcinoma Tamoxifen resistant) | 1.73 | -1.19 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, hdl cholesterol, height, infant head circumference, ldl cholesterol, total cholesterol, years of education