rs60944926 chr17:48513357 T>G
- Sequence
tgatgggagaggtgaaagtgaaag[T/G]gcaggagactcatgaggctttaac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- IRF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IRF1_HUMAN | 3.30 | n/a | 2.00 | -2.67 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Left_Ventricle, Nerve_Tibial, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood