rs6095147 chr20:48486144 T>C
- Sequence
tcctctgctcagaactctccatgg[T/C]ttccacatactcagagtaaaaccc
- ASB in cell types
- SYO-1(Biphasic synovial sarcoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| SYO-1(Biphasic synovial sarcoma) | 2.17 | n/a | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, diastolic blood pressure (dbp), ldl cholesterol, total cholesterol, urinary albumin-to-creatinine ratio