rs6096585 chr20:51801133 G>A
- Sequence
gctacaaatcccccctccccccac[G/A]cgcacgctaaaaacttatcaggcg
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.32 | 0.57 | 3.94 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Brain_Cerebellum, Cells_Cultured_fibroblasts, Colon_Transverse, Esophagus_Mucosa, Liver, Lung, Minor_Salivary_Gland, Nerve_Tibial, Pancreas, Pituitary, Prostate, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid