rs6097274 chr20:53175783 C>T
- Sequence
tcagattggtggtaccccgaccta[C/T]agacttggttagcatgtcacaaag
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- HDAC1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HDAC1_HUMAN | 2.10 | -1.08 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, age at death with kuru exposure, hdl cholesterol change with statins, obesity with early age of onset (age >2), variant creutzfeldt-jakob disease