rs6097507 chr20:38050014 A>G
- Sequence
tccttctaccgctttcactgtgtg[A/G]tgaactcattctccaagaatgcaa
- ASB in cell types
- HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.97 | 0.07 | 1.95 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP abnormal involuntary movement scale, hdl cholesterol, hdl cholesterol change with statins, ldl cholesterol change with statins, microalbuminuria, mitral annular calcium, parkinsons disease, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Cells_Cultured_fibroblasts, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Spleen, Thyroid