rs610116 chr9:126893166 A>C
- Sequence
gacaaaatgtagtaaatactttgt[A/C]aatgctggcaattaggaaatgagg
- ASB in cell types
- GM12890 (Lymphoblastoid Cell Lines) GM19193 (female B-cells Lymphoblastoid Cell Lines) GM18486 (Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12890 (Lymphoblastoid Cell Lines) | -2.08 | 2.46 | 1.00 | |||
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 2.36 | -2.02 | 1.00 | |||
| GM18486 (Lymphoblastoid Cell Lines) | 1.40 | -0.40 | 1.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, bipolar disorder, body mass index (bmi), fasting insulin, height, homa-b, homa-ir, ldl cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Esophagus_Mucosa, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid, Whole_Blood