rs6102074 chr20:40639545 G>T
- Sequence
tcacatgctaacccatcccttcag[G/T]gagccatgctcccttccatttata
- ASB in cell types
- HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | 0.54 | 0.91 | 1.02 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, body mass index (bmi), cleft lip, with or without cleft palate, cleft lip, with or without cleft palate, in asian ancestry population, comorbid depressive syndrome and alcohol dependence, ldl cholesterol, nonsyndromic cleft lip, parkinsons disease, refractive error, resistance to kuru in aged women despite likely exposure, total cholesterol, triglycerides