rs6102363 chr20:41339848 A>C
- Sequence
ctcctcaccgcccagtcgtttcta[A/C]gcctggctcgtcgccgttgctgct
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) RWPE1 (prostate epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | 1.72 | -0.63 | 1.00 | |||
| RWPE1 (prostate epithelial cells) | 1.85 | -1.55 | 1.00 |
Items per page:
1 – 2 of 2